A fertilized chicken egg is a remarkable thing. It only takes 21 days for an egg to become a chick that can move and breathe. But how long can a fertilized egg live before it needs to be incubated? Let’s look at the interesting lifecycle of a chicken egg and the things that affect its chances of hatching successfully.
The Magic 21 Days
The typical incubation period for a chicken egg is 21 days. This is the timeframe in which the embryo develops inside the shell, turning from a tiny disc into a fully formed chick ready to pip its way into the world.
During the first week, the major organs like the heart, eyes, and central nervous system begin forming. By day 14, feathers and toenails start to grow. And in the final week, the chick gets into hatching position and prepares to peck through its calcium fortress and take its first gulps of air.
So 21 days is the standard – but is it also the maximum for a fertilized egg to remain viable?
Pushing the Limits
It turns out that fertilized chicken eggs can live longer than 21 days without being in an incubator if they are kept in the right conditions. Even though embryos become less likely to hatch over time, some have been known to develop and hatch after 3–4 weeks of not being incubated.
People who keep chickens in their yards say that chicks have come from eggs that have been stored for four weeks or more. However, the chances of hatching drop significantly after 10 to 14 days. By 6 weeks, few if any embryos could remain alive.
So while 21 days is the norm, chicken eggs can last unincubated for up to 35 days in exceptional circumstances But their likelihood of hatching steadily decreases the longer incubation is delayed.
Factors Affecting Egg Viability
What makes it possible for some fertilized eggs to live for weeks outside of an incubator, breaking the 21-day rule? And what makes it possible for others to die more quickly?
1. Storage Conditions
To stay viable for extended periods, eggs must be stored properly before incubation. Keeping them:
-
At cool temperatures between 55-68°F (13-20°C).
-
With the pointy end facing down to keep the air cell stable.
-
In an environment with around 70% humidity to prevent moisture loss.
-
Clean and free of cracks or damage.
Following these guidelines preserves the egg and allows the embryo to remain dormant but alive for weeks.
2. Egg Freshness
The fresher the egg, the longer it will keep. Eggs less than 7 days old have the highest hatchability rates. After 2 weeks, their fertility drops off significantly. Older eggs over 1 month should be candled to check for signs of life before incubating.
3. Breed Differences
Some breeds, like Bantam chickens, tend to lay eggs with thicker shells and dense yolks that keep better than average. The genetics of the hen impact the durability of their eggs in storage.
4. Temperature Fluctuations
Once incubated, chicken eggs are sensitive to overcooling or overheating. Temperatures deviating more than 1-2°F from 99.5°F during incubation can jeopardize development. Minor fluctuations are tolerated, but extremes will be fatal.
5. Disturbances and Shaking
Vigorous shaking, rotation, or repositioning of eggs once incubation begins can traumatize the embryos and lead to death. After a week of sitting undisturbed, the eggs must be turned gently to prevent sticking.
6. Infections and Contamination
Bacterial infections in the parent birds, like Salmonella, can infect the egg and cause early death of the embryo, especially after 2 weeks. Cracks in the shell also raise contamination risks. Both limit how long eggs survive.
The Takeaway
While 21 days is the standard incubation duration, chicken eggs can remain viable for up to 35 days given excellent storage conditions. However, their hatchability steadily declines the longer incubation is delayed past 10-14 days. Maximize their longevity by keeping eggs cool, pointed down, and humidified before incubating according to breed guidelines. With proper care, life can persist for weeks inside a dormant egg!
So if you chance upon a forgotten fertilized egg, don’t assume it’s too late. It may still hatch a healthy chick given the right care and environment. Just be sure to candle regularly for signs of life as you approach 4 weeks. With a little luck, this egg may defy the odds and become the chick that lasted!
MRI Analyses During Incubation
The eggs stored for 3 days (D3) or 10 days (D10) were incubated. After 11, 13, or 15 days (EID11, EID13, or EID15), eggs were taken out and put in the fridge at 4°C for 1 hour and then at -20°C for 10 minutes before being analyzed with a Siemens Magnetom® 3 T (T) MRI scanner (Verio, Erlangen, Germany). Such an egg cooling was necessary to anesthetise the chick and thus avoid movements of the embryos during MRI acquisition.
For each egg, we used a single radio frequency (RF) “loop” coil with a 7-cm inner diameter. Each egg was inserted in the middle of the loop coil.
Two separate MRI sequences (T1: spin-lattice or longitudinal relaxation time and T2: spin-spin or transverse relaxation time) were performed on the whole brain, in order to get two distinct contrasts. The T1 3D and T2 3D were the Magnetisation Prepared Rapid Acquisition Gradient Echo (MPRAGE) and the Sampling Perfection with Application-optimised Contrasts (SPACE), respectively.
The acquisition parameters for these T1 and T2 anatomical analyses were as follows:
-T1 3D: repetition time (TR) = 1970 ms; echo time (TE) = 3. The frame rate was 34 ms, the inversion time was 900 ms, the flip angle was 9°, the field of view (FOV) was 81 mm2 and the matrix was 192 x 1922. The slice thickness was 0 mm. 4 mm resulting in a voxel size of 0. 42 * 0. 42 * 0. 40 mm3. A bandwidth of 150 Hz/Px and two number of excitations (NEX) producing an acquisition time of 9 min 29 s were used.
-T2 3D: TR = 1860 ms; TE = 140 ms; flip angle = 140°; bandwidth of 296 Hz/Px; and a turbo factor of 99. The inter echo space was 7.38 ms. The FOV was 70 * 70 mm2. The matrix was 192 * 1922 and slice thickness was 0.35 mm, which ended with a voxel size of 0.36 * 0.36 * 0.35 mm3. The acquisition time was 8 min 57 s.
Volumes on the MRI s were estimated based on T1 s of the yolk and the albumen, and on the T2 s for the brain, eyes, yolk sac, allantoic fluid and embryo, as T2 contrast clearly allows distinction of water content between egg compartments (Table 1). At EID13 and EID15, the yolk sac and embryo signals were merged, as the tissue aspect of the yolk sac as a very dense and vascularised tissue (Wong and Uni, 2021) resembled the embryo and both structures could not be distinguished.
For volume estimation, the Digital Imaging and Communication in Medicine (DICOM) s were converted into the Neuroimaging Informatics Technology Initiative (NIfTI) format.
The NIfTI s were read with ITK Snap, which is a free, post-processing software generally used to segment 3D medical structures (Yushkevich et al., 2006). The segmentation of “area growing” type was done automatically and then corrected manually.
After MRI analyses, eggs were weighed, embryos were removed from the eggs and decapitated and embryo weight was determined. Small pieces of the liver were collected and stored at −20°C for further analysis (molecular sexing).
Molecular sexing was performed as previously published with minor adjustments (He et al., 2019). Small pieces of EID11, EID13 and EID15 embryo livers were lysed in 150 μl of lysis buffer containing 10% of chelating beads (Chelex 100), 0.2% SDS, 10 mM Tris pH 8 and 0.2 mg/ml Proteinase K). Samples were incubated for 3 hours at 55°C followed by a 15-min incubation at 95°C. Samples were then centrifuged for 3 min at room temperature at maximum speed with a Mini centrifuge 6K (ExtraGene, Taichung City, Taiwan). Supernatants were recovered and stored at −20°C until use. DNA lysate quantification was assessed by reading the 260 nm absorbance with a micro volume spectrophotometer (Nanodrop One Thermo Scientific, Wilmington United States). Embryo lysates were diluted ten times in nuclease free water and 1 μl of dilution was mixed on ice with primer SWIM (forward: 5′- GAGATCACGAACTCAACCAG -3′/reverse: 5′- CCAGACCTAATACGGTTTTACAG -3′), which is female specific and primer 12S (forward-5′ CTATAATCGATAATCCACGATTCA- 3′, reverse: 5′- CTTGACCTGTCTTATTAGCGAGG -3′) and Dream Taq PCR Master Mix (2X), according to the manufacturer’s recommendations (Thermo Fisher Scientific, Illkirch, France). Amplification by polymerase chain reaction (PCR) was performed using a thermocycler (Eppendorf, Montesson, France), as described previously (He et al., 2019). PCR products were loaded on a 2% agarose gel containing 0.01% gel Red in 1X TAE buffer, and separated by electrophoresis at 100 V. Gels were d using a Bio-Print r (Vilber Lourmat, Marne-la-Vallée, France). Female samples exhibited two amplification products (131 bp for 12S and 212 bp for SWIM gene), while male samples exhibited only one amplification product (131 bp for 12S gene).
All statistical analyses were performed using XLSTAT software (Data Analysis and Statistical Solution for Microsoft Excel, Addinsoft, Paris, France 2017). For most parameters, normality of the samples was not achieved (Shapiro–Wilk test). Thus, all statistical analyses (except for embryo weight) were performed using a Kruskal–Wallis test (p < 0.05), followed by a pair comparison using a Mann–Whitney test (p < 0.05), when required. For embryo weight, we used an ANOVA test.
Incubation Procedures and Sampling
Freshly laid fertilised eggs were obtained from 30-week-old broiler breeder hens (ROSS 308, Boyé Accouvage, La Boissière en Gâtine, France). Eggs were all weighted and ten-egg batches of similar egg weight (56.5 ± 0.52 g) were formed. The egg weight in each batch ranged from 53 to 60.4 g to illustrate natural egg weight heterogeneity. Ten eggs were kept (D0) for analyses, while the remaining eggs were stored in the Poultry Experimental Facility (PEAT) UE1295 (INRAE, F-37380 Nouzilly, France, DOI: 10.15454/1.5572326250887292E12) in a dedicated room at 16°C, 80% RH for three (D3) or 10 days (D10). Ten eggs were collected at D0, D3 and D10 and were analysed by computed tomography, followed by the measurement of some egg quality parameters. The day before incubation 60 D3 and 60 D10 eggs were placed at room temperature (45% hygrometry), and then transferred into a 3900-egg incubator (Bekoto B64-S, Pont-Saint-Martin, France) set at 37.8°C, 55% RH (automatic turning every hour, large end of eggs on top). After 11, 13 and 15 days of incubation (Embryonic incubation day 11, 13 and 15 or EID13, EID13, and EID15, respectively), D3 and D10 eggs containing viable embryos were analysed by computed tomography while others were selected for MRI analyses. After CT and MRI acquisitions, all eggs were weighed and opened to collect embryos that were killed by decapitation. This experimental procedure meets the guidelines approved by the Institutional Animal Care and Use Committee (IACUC). Dead embryos were weighed and a small piece of the liver was collected, kept at −20°C for molecular sexing.
How Long Can an Egg Sit Before a Hen Starts Sitting on Them?
FAQ
How long is a fertilized chicken egg good for?
A fertilized egg can be kept in a cool room at a steady 55 to 60 degrees Fahrenheit for up to seven days before it is incubated. It should not be kept in the fridge because it’s too cold!
How to keep fertile eggs before incubation?
Before laying eggs, make sure they are stored properly by keeping them in a cool, dry place that is between 55 and 60°C (13 to 16°C). The humidity should be between 70 and 75%. Turn the eggs daily, and store them pointy end down.
How to tell if a fertilized egg is still alive?
If you’re not sure if the embryo is still alive, put the egg back in the incubator and check again more quickly. A second test can be made after 14 to 16 days of incubation. If the embryo is living, only one or two small light spaces filled with blood vessels can be seen, and the chick may be observed moving.
Will fertile eggs hatch if they get cold?
Don’t put an egg you want to hatch in the fridge–the cold will kill the embryo. Hatching eggs should be clean and stored at 55–65 F and 70–80% humidity. Even then, hatchability fall off quickly after 10 days in storage.